El reto:

Realice una función que encuentre el palíndromo más largo dentro de una cadena.

^{Nota: Esta es una pregunta de arrastre de código . No tome en serio la pregunta y / o las respuestas. Más información aquí .}

Ir

La siguiente solución en Go emplea los poderes ocultos de concurrencia, cierre y recursividad para encontrar el palíndromo más largo dentro de una cadena dada:

func lp(s string) string {
    for i, l := 0, len(s); i < l; i++ {
        if s[i] != s[l-i-1] {
            a, b := make(chan string), make(chan string)
            go func() {
                a <- lp(s[:l-1])
            }()
            go func() {
                b <- lp(s[1:])
            }()
            c, d := <-a, <-b
            if len(c) > len(d) {
                return c
            }
            return d
        }

    }
    return s
}

Además, se basa completamente en primitivas de lenguaje y tipos incorporados, sin biblioteca estándar, así es como se reconoce el software de verdadera calidad.

Es posible que desee aumentar un poco sus límites de hilo, memoria y pila para cadenas de entrada más grandes; esto se debe a que esta solución es tan rápida que su sistema operativo se pondrá celoso.

Editar - Beneficios:

• totalmente inútil en cadenas de caracteres multibyte.
• no omitirá la puntuación ni los espacios en blanco.
• omite la igualdad de mayúsculas / minúsculas.
• funciona en un tiempo difícil de calcular, aunque muy lento.
• genera montones y montones de gorutinas, dependiendo de la entrada.
• muere por agotamiento de la memoria después de un par de segundos en mi máquina con más de 16000 2049186 goroutines generadas para la entrada"345345ABCDEabcde edcbaDEABC12312123"

Pitón

def longest_palindrome(s):
    return 'racecar'

Ejemplo de uso:

>>> print longest_palindrome('I like racecars!')
racecar

Nota: esto solo puede funcionar para ciertas cadenas.

Claramente, verificar Palindromes es difícil.

Entonces, la solución es bastante simple: genere un conjunto de cada Palindrome posible tan grande como la cadena que está probando, y vea si su cadena lo contiene.

DO#

string largest = String.Empty;

    for(int i=0; i < myString.lenght; i++)
    {

//Don't use the newfangled stringbuilder. Strings are awesome
char[] testString = new char[i];

    for (int charPosition=0; charPosition < i/2; charPosition++)
    {
    for (char c = 'A'; c <= 'Z'; c++)
    {
       if ((charPosition/i) == i/2)
{
//middle one
testString[i] = c;
} 
else 
{
//do one for that position, and the lenght-position
testString[i] = c;
testString[testString.length - i] = c;
}

if (myString.Contains(testString.ToString())
{
//yaay
largest = testString.ToString();
}


{

}
    } 

}


}

(Es posible que deba verificar la corrección de mi código, pero de lo contrario es una forma maravillosamente horrible e ineficiente de buscar Palindromes)

Perl

¿Todo lo pedido? En realidad es mejor, porque tiene en cuenta todas las subsecuencias posibles . ¿Cuál es el truco? Funciona en tiempo exponencial, por lo que cada carácter adicional en la cadena duplica el tiempo de ejecución. Dale más de 20 caracteres, y te llevará todo el día.

$inputstring = <>;
@arrayofcharacters = split("",$inputstring);
for(0..2**length($inputstring)-1){
 $currentsubsequence = "";
 @choice=split("",sprintf("%b",$_));
 for(0..$#arrayofcharacters){
  $currentsubsequence .= "$arrayofcharacters[$_]" x $choice[$_];
  if($currentsubsequence eq reverse($currentsubsequence)){
   $palindromes{length($currentsubsequence)} = $currentsubsequence;
   $palindromes[~~@palindromes] = length($currentsubsequence);
  }
 }
}
print($palindromes{@{[sort(@palindromes)]}[$#palindromes]})

Entrada: iybutrvubiuynug. Salida: ibutubi.

Entrada: abcdefghijklmnopqrstuvwxyzzyxwvutsrqponmlkjihgfedcba. Salida: no sucederá

Su problema se resuelve fácilmente con expresiones regulares, al igual que en la imagen a continuación (pero decidí usar java en su lugar). Esto sucede porque regex es siempre la mejor herramienta que se puede usar para cualquier cosa que implique extraer o analizar texto.

package palindrome;

import java.util.regex.Pattern;
import javax.swing.JOptionPane;

public class RegexPalindrome {

    private static String next(String now) {
        if (now.isEmpty()) return "a";
        String prefix =  now.length() == 1 ? "" : now.substring(0, now.length() - 1);
        if (now.endsWith("z")) return next(prefix) + "a";
        return prefix + String.valueOf((char) (now.charAt(now.length() - 1) + 1));
    }

    public static void main(String[] args) {
        String text = JOptionPane.showInputDialog(null, "Type some text:");

        String bestPalindromeFound = "";

        for (String searchText = "a"; searchText.length() <= (text.length() + 1) / 2; searchText = next(searchText)) {
            String reverse = new StringBuilder(searchText).reverse().toString();
            if (searchText.length() * 2 - 1 > bestPalindromeFound.length()) {
                Pattern p = Pattern.compile(".*" + searchText + reverse.substring(1) + ".*");
                if (p.matcher(text).matches()) bestPalindromeFound = searchText + reverse.substring(1);
            }
            if (searchText.length() * 2 > bestPalindromeFound.length()) {
                Pattern p = Pattern.compile(".*" + searchText + reverse + ".*");
                if (p.matcher(text).matches()) bestPalindromeFound = searchText + reverse;
            }
        }
        JOptionPane.showMessageDialog(null, "The longest palindrome is \"" + bestPalindromeFound + "\".");
    }
}

Este código es malo porque:

• Se ejecuta en tiempo exponencial al tamaño del texto dado. Se ejecuta enumerando todas las cadenas en la forma az, creando dos expresiones regulares para cada cadena generada y probando la entrada contra cada expresión regular.
• Además, falla si el palíndromo contiene letras mayúsculas, números, texto no ascii, puntuación, etc.
• Y, por supuesto, regex claramente no es la herramienta adecuada para eso.

Pitón

Esto toma la cadena y la reorganiza en el palíndromo más largo posible disponible.

Por ejemplo:

Entrada: hola

Ouput: lol

def get_palindrome(string):
    if len(string) == 0:
        return "I didn't catch that"
    list_of_characters = []
    occurances = []
    for character in string:
        if not character in list_of_characters:
            list_of_characters.append(character)
            occurances.append(1)
        else :
            occurances[list_of_characters.index(character)] +=1
    #check if a palindrome is possible
    if sum(occurances) == len(occurances): #no double letters, so only a one character palindrome
        return list_of_characters[0]
    first_half = ''
    second_half = ''
    middle_character = ''
    for index, character in enumerate(list_of_characters):
        number_of_occurances = occurances[index]/2
        first_half += character * number_of_occurances
        second_half = (character * number_of_occurances)+ second_half
        if (occurances[index]%2 != 0):#if there are an odd number, there will be one spare,
            #so put it in the middle
            middle_character = character
    return first_half + middle_character + second_half


print(get_palindrome(raw_input("String containing palindrome:")))

interpretación bioinformática

Muy buena pregunta amigo!

Los palíndromos en lenguaje normal no se especifican del todo con claridad, por ejemplo, si se permiten espacios o no. Por lo tanto, no está claro si deberían permitirse como palíndromos o no:

• ¿Los gansos ven a Dios?
• Un hombre, un plan, un canal - ¡Panamá!

De todos modos, creo que te estás refiriendo al significado científico mejor especificado del palíndromo: para que una secuencia de nucleótidos se considere palíndromo, su cadena complementaria debe leer lo mismo en la dirección opuesta. Tanto las cadenas como la cadena que va de 5 'a 3' y su cadena complementaria de 3 'a 5' deben ser complementarias (ver aquí ).

Se han realizado algunas investigaciones para el reconocimiento de secuencia de palíndromo y creo que realmente debería leer al menos esto . Para resolver su problema, ¡puede simplemente copiar su enfoque! El profesor incluso envía el código fuente si le preguntas.

Bueno, ahora al problema en cuestión. Suponga que tiene una secuencia de nucleótidos dada como una cadena de caracteres. La mejor manera de encontrar palíndromos en tal secuencia es mediante el uso de algoritmos estándar. Creo que su mejor opción es usar esta herramienta en línea: http://www.alagu-molbio.net/palin.html

Dado que debe proporcionar una función que realice la tarea, debe pensar en cómo introducir su cadena en esta aplicación. Bueno, ahí comienza la diversión. Creo que podrías usar selenio para eso. Como no quiero hacer tu tarea, solo te doy la idea básica. En Java tu mundo comienza así:

package testing;

import java.util.regex.Matcher;
import java.util.regex.Pattern;

import org.openqa.selenium.By;
import org.openqa.selenium.WebDriver;
import org.openqa.selenium.WebElement;
import org.openqa.selenium.phantomjs.PhantomJSDriver;

public class PalindromeService {


    public static void main(String[] args) {
        WebDriver d1 = new PhantomJSDriver();

        d1.get("http://www.alagu-molbio.net/palin.html");

        String sequence = "AAGTCTCGCGAGATCTCGCGAGATCTCGCGAGATCTCGCGAGAAA";

        WebElement txtArea = d1.findElement(By.tagName("textarea"));

        txtArea.sendKeys(sequence);

        WebElement send = d1.findElement(By.cssSelector("input[type=submit]"));
        send.click();

        String result = d1.findElement(By.tagName("body")).getText();

        Pattern p = Pattern.compile(".*capitalized\\.[^agctACGT]*([agctACGT]+).*");
        Matcher m = p.matcher(result);
        if (m.find()){
            result = m.group(1);
        }

        //now you have all palindromes in upper case! 
        //I think you can take it from here, right?

        System.out.println(result);

        d1.quit();
    }
}

En caso de que esté interesado en los palíndromos del lenguaje, puede usar la misma técnica con otros servicios web como http://www.jimsabo.com/palindrome.html o http://calculator.tutorvista.com/math/492/palindrome-checker .html

técnicas de arrastre de código

• omita las fuentes verdaderamente útiles como http://rosettacode.org/wiki/Palindrome_detection

• bla interesante pero poco útil sobre bioinformática

• malinterpretando deliberadamente esto como tarea bioinformática

• trampa - para resolver el problema se utiliza un servicio web

Pitón

def get_substrings(a_string):
    """Get all possible substrings, including single character substrings"""
    for start_index in range(len(a_string)):
        for end_index in range(start_index + 1, len(a_string) + 1):
            yield a_string[start_index:end_index]

def get_longest_palindrome(a_string):
    """Find the longest palindrome in a string and return its index or -1"""

    # Initialise variables
    longest_palindrome = get_longest_palindrome.__doc__[5:27]
    palindromes_list = []

    # Search string for all palindromes
    for substring in get_substrings(a_string):
        if reversed(substring) == substring:
            palindromes_list.append(substring)

    # There should always be palindromes in non-empty strings (single characters),
    # but it's good practice to check anyway
    if len(palindromes_list) > 0:
        longest_palindrome = max(palindromes_list, key=len)

    return a_string.find(longest_palindrome)

La cadena "el palíndromo más largo" se extrae de la cadena de documentos longest_palindrome.

La reversed()función devuelve un iterador, por reversed(substring) == substringlo que nunca será verdadero y longest_palindromenunca se sobrescribirá.

Por lo tanto, la función literalmente encontrará "el palíndromo más largo" dentro de una cadena.

Javascript

Oh, eso es fácil;). Aqui tienes:

function () {
    var palidrome = "Star? Not I! Movie – it too has a star in or a cameo who wore mask – cast are livewires.

Soda-pop straws are sold, as part-encased a hot tin, I saw it in mad dog I met. Is dog rosy? Tie-dye booths in rocks.

All ewes lessen ill. I see sheep in Syria? He, not I, deep in Syria, has done. No one radio drew old one.

Many moths – I fondle his; no lemons are sold. Loot delis, yob, moths in a deli bundle his tin. Pins to net a ball I won – pins burst input. I loot to get a looter a spot paler. Arm a damsel – doom a dam. Not a base camera was in a frost, first on knees on top spot. Now a camera was a widened dam.

Ask: Cold, do we dye? No, hot – push tap, set on to hosepipe. Nuts in a pod liven.

A chasm regrets a motto of a fine veto of wars. Too bad – I all won. A sadist sent cadets – a war reign a hero derides. A bad loser, a seer, tossed a cradle – he begat to cosset – a minaret for Carole, Beryl, Nora. We’re not as poor to self.

I risk cold as main is tidal. As not one to delay burden, I don’t set it on “hot”. A foot made free pie race losses runnier. As draw won pull, eye won nose. Vile hero saw order it was in – even a moron saw it – no, witnessed it: Llama drops – ark riots. Evil P.M. in a sorer opus enacts all laws but worst arose. Grab a nosey llama – nil lesser good, same nicer omen.

In pins? No, it is open. If a top spins, dip in soot.

Madam, as I desire, dictates: Pull aside, damsels, I set a rag not for a state bastion. A test I won e.g. a contest I won.

Kidnap, in part, an idle hero. Megastars, red, rosy, tied no tie. Blast! A hero! We do risk a yeti’s opposition!

He too has a wee bagel still up to here held.

Demigods pack no mask, cap nor a bonnet, for at last a case is open – I left a tip – it wets. A dog wets too. Radios to help pay my tip, pull a tip.

Ale, zoo beer, frets yon animal. Can it? New sex arose but, we sots, not to panic – it’s ale – did I barrel? Did I lose diadem, rare carrot in a jar of mine? Droop as tops sag – unseen knots.

A cat ate straw as buck risk cud; evil foe, nil a red nag ate? Bah! Plan it – silage. Model foot in arboreta.

I, dark Satanist, set fire – voodoo – to slat. I design a metal as parrot, I deem it now. One vast sum is no ten in set – amen! Indeed, nine drag a yam, nine drag a tie. Dame nabs flower; can we help man? Woman is worse nob.

Mud level rose, so refill a rut. A nag of iron I made to trot I defied – I risk leg and its ulnae. Can a pen I felt to bid dollar or recite open a crate, open a cradle, his garret?

Sample hot Edam in a pan. I’m a rotten digger – often garden I plan, I agreed; All agreed? Aye, bore ensign; I’d a veto – I did lose us site. Wool to hem us? No, cotton. Site pen in acacias or petals a last angel bee frets in.

I met a gorilla (simian); a mate got top snug Noel fire-lit role. Manet, Pagnol, both girdle his reed bogs.

Flan I reviled, a vet nods to order it, Bob, and assign it. Totem users go help mates pull as eye meets eye. Son – mine – pots a free pie, yes? No. Left a tip? Order a dish to get. A ring is worn – it is gold. Log no Latin in a monsignor, wet or wise. Many a menu to note carrot.

Cat in a boot loots; As I live, do not tell! A bare pussy, as flat on fire, I know loots guns, fires a baton, nets a hero my ale drop made too lax.

If it is to rain, a man is a sign; I wore macs, no melons rot. I use moths if rats relive, sir, or retire.

Vendor pays: I admire vendee, his pots net roe. Nine dames order an opal fan; I’ll ask cold log fire vendor to log igloo frost. Under Flat Six exist no devils.

Marxist nods to Lenin. To Lenin I say: “Mama is a deb, besides a bad dosser.”

Gen it up to get “ova” for “egg”. I recall a tarot code: yell at a dessert side-dish sale. Yes/nos a task cartel put correlate: E.S.P. rocks a man. I am a man, am no cad, I’m aware where it’s at!

Fire! Its an ogre-god to help, man, as I go. Do not swap; draw, pull a troll!

It’s not a cat I milk – calf, for a fee, sews a button – knit or tie damsel over us. Mined gold lode I fill until red nudes I met in a moor-top bar can. I sit, I fill a diary – trap nine men in ten-part net – oh, sir, I ask, cod nose? No, damp eel.

So, to get a name! I say, Al! I am Al! Last, I felt, to breed, deer begat.

To can I tie tissue – damp – or deliver Omani artist – a man of Islam.

In a den mad dogs lived on minis a signor who lived afore targets in at. As eremites pull, I, we, surf, fantasise, mend a bad eye. No hero met satyr; Tony, as I stressed, won’t, so cosset satyr.

A vet on isles made us sign it, a name. Foe man one sub.

Aside no dell I fret a wallaby; metal ferrets yodel, like so. On a wall I ate rye. Bored? No, was I rapt! One more calf? O.K., calf, one more, bossy! No! Lock cabin, rob yam, sip martini. Megastar was in a risk.

Cat? No, I’m a dog; I’m a sad loyal pet. A design I wore – kilts (a clan); if net drawn, I put it up. Royal spots snag – royal prevents rift.

Composer, good diet, are both super, God – label it a love of art, lustre. Video bored, no wise tale e.g. a mini tale – no sagas seen. Knack: cede no foes a canal.

Pay – as I sign I lie; clear sin it is; e.g. “Amadeus” sign I – lira for ecu, decimal – sin as liar.

Trad artistes pull a doom, a drawer won’t.

Is it sold loot? No, I suffered loss. A man is god; Amen! I came nice Tahiti (sic).

It’s ale for a ban if for a fast – is role to help mash turnip? Use zoo? No – grasp order – use no zoos. Warts on time did sag.

No grade “X” “A” Level? Oh, “A”! I’d a “B” or a “C”. So – pot? No, we lop. Date? Take no date! Bah! Play L.P.

Miss (a lass, all right?) flew to space in NASA era. Rose no (zero) cadets ate raw. As a wise tart I fined rags red Lenin, we help pay bet – a risk – cash to Brian. I put a clam in a pool – a pool wets.

Mahdi puts a stop to harem – miss it in one vote, lost in one, veto of none. Post-op, no tonsil; I ate; no tastier, eh? We sleep at noon time so I dare not at one; no time stops as I time tides. A bed: under it, roll; in a mania, panic!

In a pond I did as Eros as Lee felt tenrec. “Ink” – list it under “I”. Termites put pen in a way. Democrats wonder, I too. To slay moths a dog did.

I saw elf; elf, far now, is a devilish taboo, rag-naked. I hid a bootleg disc. I, saboteur, toss it in. Oops! No legs! Laminated, a cask, conker in it, negates all if it is simple.

Hot pages are in a mag, nor will I peer, familiar tat, so lewd, native rot. Toner, ewe wore no trace; vagabond ewes do. Oh, Ada! Have pity! A pitiable eel – “Oh wet am I!” – to save, note: bite gill as I do.

Call a matador minor, eh? As I live, don’t! Is torero no rigid animal debaser if tipsy? Ale drew esteem in a matador. A bolero, monks I rate play or go dig rocks; a can I step on.

Go! Gas – it evades a bedsit – set a roost on fire. Boss sent a faded eclair to green imp or dog, I’d don a belt to boot it; if Ada hid a boot, panic.

I mock comic in a mask, comedian is a wit if for eventide. Vole no emu loved is not a ferret, so pet or witness a weasel if not. I hired less, am not so bossy, as yet amateur.

To stir evil, Edna can impugn a hotel: bad loos, hot on Elba: I may melt. Tart solicits it rawer, gets it rare. Push crate open; I ram buses, use no trams.

Did I say, not to idiot nor a bare ferret, to trap rat, strap loops rat? Stewpot was on. Hot? I was red! Lessen it! Fine man on pot? No, pen inside by a bad law. So I made rips – nine delays.

Some Roman items in a.m. ordered “Is room for a ban?” “It is,” I voted: I sat pews in aisle. Beryl, no tiro to my burden, made off for a contest, I won kiss. I may raid fine dales. I raid lochs if I to help am.

Forecast for Clare v. Essex: If no rain, a man is ref. Fusspots net foxes.

Senor is a gnome, latinos’ bad eyesore. Help misses run to border, Casanova, now, or drab hotel.

Ma has a heron; I sleep, pet’s on nose, sir! Rev. I rag loved art live – fine poser. Ultra-plan: I feign, I lie: cedar to disperse – last one? No, last six. Enamel bonnet for a dark car to toss a snail at. In it all, Eve lost; Seth’s a hero slain on a trap – Rise, Sir Ogre Tamer.

Upon Siamese box I draw design. I, knight able to help, missed an alp seen in Tangier of fine metal pots. Tin I mined rages – order nine, melt ten. Tone radios; tones are not to concur. Ten-tone radar I bomb – best fire-lit so hostel side meets eerie mini red domicile. A gulf to get is not a rare tale; no time to nod.

Row on, evil yobs, tug, pull. If dogs drowse, fill a rut. An era’s drawers draw. Put in mid-field in a band I dig a tub deep. Staff on a remit did refill a minaret.

Sam’s a name held in a flat, or, sir, bedsit. I wonder, is it illicit ore? No ties? A bit under? Retarded? Is ‘owt amiss? I’m on pot; not so Cecil, a posh guy a hero met. A red date was not to last so Cecil sat.

Tip? An iota to pay, a dot; sad, I drop item. I’d ask, call, Odin, a Norseman’s god: “Pay payee we owe radio dosh o.n.o.” I to me? No, I to media.

Peril in golf – is ball a “fore”? K.O.!

Vexed I am re my raw desires. Alto has eye on nose but tone-muser pianist is level-eyed. I lost a tie. Blast! In uni no grades are musts. Avast! Never port! Sea may be rut.

Part on rose? – It’s a petal. Define metal:

Tin is . (I gulp!) can!

I am a fine posse man, I pull a ton. Ron, a man I put on, I made suffer of evil emu’s sadism. Leo’s never a baron – a bad loss but evil – topple him, Leo’s lad. Assign a pen, can I? A pal is note decoding.

Is damp mule tail-less? No, ill; I breed for its tone. Radio speed, to grower, grew. Open a lot? No, stamp it; if for a free peso – not ecu -deign it. Times ago stone rates, e.g. at Scilly, display a wont.

No wish to get a design I, Sir Des, I’ve let? No bus sees Xmas fir. O.K. – cab – tart it up; tie lots – diamond, log or tinsel; first end errata edit. So “le vin (A.C.)”, Martini, Pils lager, one tonic.

I pegged a ball up to here when I got a top star role, Beryl. Gun is too big – won’t I menace? Yes? No?

Ill? A cold? Abet icecap’s nip. U.S.A. meets E.E.C. inside tacit sale – see! Beg a cotton tie, ma! No trial, so dodo traps exist. Arabs under-admire card label good hood stole.

In rage erupted Etna. Will a rotunda, bare villa, to tyro. Lack car? Non-U! Get a mini! My, my, Ella, more drums per gong; get a frog – nil less. Rod, never ever sneer. Got to?

I disperse last pair of devils (ah!) here today or else order cash to breed emus. Said I: “Are both superlative?” C.I.D. assign it lemon peel still. I wore halo of one bottle from a ref (football) – a tip; so hit last ego slap a mate got.

Late p.m. I saw gnu here (non-a.m.) or an idea got a dog to nod – I made felt to boot.

Fill in a lad? Nay, not all, Edna – lash to buoy. Did you biff one Venus? Not I! “Broth, girl!” ladies ordered – “No, with gin!” – a fine plate, maybe suet; no carton I made rots in it.

Med: a hill, Etna, clears in it. Ali, Emir, to slap in/slam in. All in all I made bad losers sign it – alibi. Set a lap for a level bat.

A bed, sir, eh? To put cat now? Drat! Such an idyll of a dog’s lair! That`s it, open it – a cage! Big nit sent rat! Some day (A.D.) send ewe. No, draw a pot now, do! Of wary rat in a six ton tub.

Edna, ask satyr: “Tel. a.m.?” No, tel. p.m.; Israeli tuner is damp. Use item: “Anna Regina”. No! Dye main room (“salle”) red!

Nice caps for a sea cadet in U.S.A. – Now I, space cadet, am it, sea vessel rep. Pin it on Maria, help Maria fondle her fine hotpot. No! Meet; set up to net, avoid a lesion. Set acid arena: Bruno one, Reg nil. Like it to sign in? Even I am nine-toed! I vote votes.

Oh, can a nose-rut annoy? No, best is Dorset. I know, as liar, to snoop, malign. “I’ll order it to get a bedroom door,” began a miser I fed.

Am I to peer, fan? Is a door by metal? Ere sun-up, drowse, nod, lose magnet. Food? Buns? I’ll ask. Corn? I’ll ask. Corn – I snack. Cats snack (cold rat). Sum for a bag: nil. First, is remit “traps in net”? Yes, on a par. Coots yell over a dam I made. Bared nudist went a foot, I made roots. I tip a canon: “Row, sir, at same tide; man one: row tug.”

Sewer of denim axes a wide tail – a terror recipe to hero made manic. I, to resign? I ? Never!

“OFT I FELT ITS SENSUOUSNESS” – title fit for evening is erotic; I named a more hot epic – error retaliated – I was examined for ewe’s gut, wore no named item.

A star is worn on a cap, it is too red. Am I too fat? Newts I’d under a bed. Am I mad? Are volleys too crap? A nosey tennis part-timer sits rifling a bar of mustard.

Lock cans, stack cans in rocks, all in rocks, all I snub. Do often games, old ones, word-pun use; relate, my brood, as in a free pot I made fires, I manage brood. Moor debate got tired rolling, I lampoon, so trail saw on kites.

Rod sits, ebony on nature, so Nana chose to veto video. Ten in main evening is O.T.T. i.e. killing; Ere noon, urban eradicates noise, lad, I ovate not. Put esteem on top (to hen, if reheld).

No fair ample hair – am not I nipper-less? Eva estimated ace caps I won as united. A Caesar of space, Cinderella’s moor, Niamey Don (a Niger-an name), ties up mad sire, nut! I, Lear, simpleton male, try tasks “A” and “E”

but not “XI”. Sanitary raw food won top award one Wednesday – a demo.

Start nesting, I beg a cat. I? Nepotist? Ah, trials, God! A folly, Dinah, custard won’t act up; other is debatable. Velar: of palate; sibilating is “s”.

Resold: a bed, a mill, an ill animal – snip, also trim. Eilat in Israel can tell I had ‘em. Tin I stored (am I not raconteuse?) by a metal pen. If a night, I wondered, rose, I’d all right orbit on sun, even off.

I buoy, did you? Both Sal and Ella, Tony and Alan (“Ill if too bottle-fed, am I?”) do not. God! A toga! Ed in a Roman one, rehung! Was I, M.P. et al., to get a map? Also get salt? I, hospital lab to offer, am, or felt to be, no fool – a hero.

Will it sleep? No, melting is sad ice. Vital re-push to be raid, I assume. Deer, both sacred roes, Leroy (a doter, eh?) has lived for. I, apt sales rep’s idiot to greens, revere vendors selling or fat egg-nog reps.

Murder O’Malley, my mini mate – gun on rack. Calory total: liver, a bad nut or all I wanted (“et puree garnie”): lots. “Do, oh do, ogle bald racer,” I’m dared – N.U.S. bar at six.

Esparto, dodo’s lair to name it, not to cage bees, elasticated, is nice. Esteem, as up in space, cite bad local lions, eye can emit now. G.I. boots in ugly rebel or rat’s potato gin (eh?) were hot. Pull a bad egg – epic, I note, no regal slip in it. Ram can . (I’ve lost idea!)

Tarred nets, rifles, nitro, gold – no maid stole it. Put it, rat, back or if Sam (“X”) sees sub on televised rising, I sedate Goths. I won’t – no way.

Alps, idyllic stage set, are not so gas-emitting, I educe. To nose, peer, far off, I tip mats onto lane. Power grew or got deep so I dare not stir. Of deer, billions sell. I ate lump – mad sign, I do cede – tonsil a pain, acne pang is sad also. Elm I help pot, live – tub’s sold; a ban or a bar, even so, elms, I’d assume, live for. Effused am I not, up in a manor, not all up in a mess.

Open if a main A.C. plug is in it.

Late men I fed late – pasties or not. “Rapture” by a maestro prevents a vast sum erased.

Argon in units, albeit at solid eye level, sits in a . (I presume not) . tube, son. No eyes: a hot laser – is Ed wary?

Mermaid, ex- evoker of all A.B.s, I flog. Nil I repaid. Emotion! Emotion, oh so do I dare, woe!

Wee yap-yap dog’s name’s Ron. An idol lacks a dime tip, or did, as today a potato in a pitta slice costs a lot – tons. A wet adder ate more hay. Ugh! So, pal, ice cost on top? No, miss, I’m a two-sided rat, erred nut, I base it on erotic ill; It is I, red now; it is debris, rot.

Alf, an idle he-man as “master animal lifer” did time, ran off at speed, but a G.I. did nab an idle if dim nit. Upwards rewards are natural life’s words, God. Fill up guts, boy, live now or do not emit one later. A rat on site got flu.

Gaelic, I’m odd Erin, I’m Eire, esteemed islet. So hostile rifts ebb. Mob, I.R.A., dare not net R.U.C. – no cotton. Erase not, so I dare not nettle men in red rose garden – I’m in it.

Stop late men if foreign at nine. Esplanades, simple hotel, bath, gin – king is Edward IX; obese; Ma is no pure mater. Go! Rise, sir; part anon.

I also rehash tests – ‘O’ Level Latin, Italian. S.A.S., so, to track radar. Often nobleman exists alone – not sales reps – I do. Trade ceiling, i.e. final part, lures open if evil trade.

Volga River rises on no steppe. Elsinore has a hamlet – Oh, Bard, row on Avon!

A sacred robot nurses simple hero’s eye; dabs on it a lemon. Gas, iron, Essex often stops, suffers in a mania. Ron fixes several crofts, acer of maple. Hot, I fish; cold, I arise laden; if diary amiss, I know it set no car off. Foe-damned ruby motor, it only rebels.

Ian I swept aside to visit, in a bar of moorside red, Romanis met in a more mossy ale den. Inspired am I, Oswald. A bay bed is nine p on top. No name, niftiness- elder saw it. Oh no! Saw top wet star’s pool – part star, part otter. Refer a baron to idiot, Tony, as I did.

Smart ones use submarine.

Poet, arch-super-artiste, grew artistic. I lost rattle; my amiable, not oh so old, able to hang up, mina, can deliver it, so true. “Ta, matey!” – says so Boston (Mass.) elder I hit.

On file S.A.E. was sent – I wrote poster re fat on side, volume one – loved it, never off it, I was in. Aide mocks a manic; I mock comic, I nap: too bad I had a fit, I too. Bottle ban odd, I go drop mine, ergo trial ceded a fatness, sober if not so, or a test is debased.

A vet is agog – no pet’s in a cask – corgi dog, royal pet, a risk no more.

Lob a rod at a man I meet. Sewer delays pit fires – a bedlam in a dig – iron ore rots it. No devil is a hero – Nimrod.

At a mall a cod is all I get. I bet on Eva, so Tim ate whole eel bait, I pay tip, Eva had a hood sewed. No B.A. gave car to Nero, we were not to rev it and we lost a trail; I’m a free pill, I wrong a man. I erase gap; to help miss it, I fill a set. A gent in ire knocks a cadet.

Animals’ gel on spoon – it is so true to basics – I’d gel; too bad I hide kangaroo baths – I lived as I won raffle, flew as I did go, dash, to my, also too tired now, star comedy: A wan, inept, upset I’m retired, nut; its ilk, nicer. Nettle feels a sore; sad, I did no panic in a pain, am an ill or tired, nude, based item; it is a spot.

Semitone, not a tone, radios emit; no, on tape; elsewhere it’s a tone.

Tail is not on; pots open on foot, even on it, so let oven (on, it is) simmer – a hotpot’s a stupid ham stew.

Loop a loop, animal – cat up in air.

Both sacks I rate by apple hewn in elder’s garden if it rates, I was aware – tasted a core.

Zones or areas, Annie, cap, so twelfth girl, lass, alas, simply (alpha beta) done, Kate. Tadpole won top Oscar, Obadiah, “O” Level axed.

Argon gas did emit no straw, so ozone sure drops argon, oozes up in Ruth’s ample hotel or sits afar off in a bar – of elastic, is it?

I hate cinema; cinema dogs in a mass. Older effusion to old – lost, is it now? Reward: a mood.

All upsets it.

Radar trails an Islamic educer of a riling issue, damages it in Israel. Ceiling is, I say, a plan, a case of one deck. Can knees sag as one Latin image elates, I wonder?

Oboe diverts ultra foe, volatile bald ogre – push to berate; I’d do, ogre. So, p.m., Oct. first, never play organ’s stops – lay or put it up in ward ten.

Final cast like rowing – I sedate play, old as am I, God! Am I! On tacks I ran; I saw rats. A Gemini tramp is May born.

I back colony’s sober omen of lack of lace. Rome, not Paris, a wonder.

Obey retail law – a noose killed oyster. Reflate my ball, a water-filled one. Disabuse no name of emanating issue.

Damsels, I note, vary tastes so cost now desserts. I say no! Try taste more honeyed. A bad nemesis at naff ruse will upset. I, mere Satanist, e.g. rater of a devil – (Oh wrong is a sin!) – I’m no devil’s god, damned.

Animals, if on a mat, sit. Rain, a more vile drop, made us site it in a cottage. Breed deer – bottle fits a llama.

I lay, as I emanate, go to sleep, mad ones on docks – air is hot. Entrap, net, nine men in party raid – all if it is in a crab-pot room, an itemised, under-lit, nullified old log den – I’m sure voles made it rot in knot.

Tubas we see far off lack limit. A cat on still or tall upward paws to no dog is an ample hot-dog, ergo nastier if tastier, eh? We, raw amid a conman, a mama in a mask, corpse et al., err.

Octuple tracks at a son’s eyelash side distressed a tall eye doctor, a tall ace, rigger of a vote: got put in egress; odd, abased, is ebbed, as I am, Amy, asinine lot! Nine lots! Don’t six rams live? Don’t six exist?

Alfred, nuts or fool gigolo, trod never if gold locks all in a flap on a red rose; made nine or ten stops.

I heed never, I’m Daisy, a prod never, I terrorise viler starfish. To me suitors, no lemons, came rowing. Is a sin a mania? Rot!

Sit! I fix a looted amp or delay more, hasten not. A baser if snug stool, wonkier, if not – Alf says – super, a ballet to no devil, is a stool too. Ban it, actor, race to no tune.

May names I wrote wrong (Is no man in it, a long old log?) sit in row, sign irate Goths; I dare drop it. At felon’s eye I peer, fast open – I’m nosey, esteem eyes. All upset, ample hogs resume totting. Is sad nabob tired? Roots don’t evade liver in Alf’s gob.

Deers I held right; oblong, apt enamel or tile rifle on gun spot to get a man – aim is all. I rogate, minister. Feeble gnats, alas late, prosaic, a canine pet is not to consume hot.

Loo, wet, issues old idiot; evading, I sneer, obey a deer, gall a deer, gain alpine dragnet for egg I’d net to ram in a pan I made to help master. Rags I held, arcane poet, arcane poetic error, all odd; I bottle fine panacean lust. I’d nag elks I ride if editor toted a minor. I fog a natural life.

Roses, or level dumb ones – rows in a mown, ample, hewn acre. Wolfsbane made it a garden in May, a garden indeed.

Nine mates, nine tons I must save now on time – editor raps a late man. G.I.s edit also, too. Do over if tests in a task radiate. Rob ran; I, too, fled.

“Omega” – list in alphabet.

A gander, a line of live ducks, irk cubs. A wart, set at a cast on knee, snug as spots.

A poor denim for a janitor, racer, armed aide, solid idler – rabid; I’d elastic in a pot, tons to sew.

Tubes or axes went in a clam, in an oyster. Free booze – lap it all up. Pity, my apple hot, so I’d a root stew. God, a stew! Tip it at feline! Posies, a cat’s altar often, no baron packs. A monk caps dog – I meddle here – hot? Pull its leg! A bee was a hoot, eh?

No, it is opposite. Yaks I rode wore hats, albeit on deity’s orders. Rats age more held in a trap, nip and I know it – set no cage now.

It’s eta; no, it’s a beta – Tsar of Tonga rates isles. Mad Ed is all upset at cider, is Ed? Is a madam too? Snip? I’d snip, spot a fine position, snip nine more cinemas.

Do ogres sell in a mall? Yes, on a barge so rats row tubs.

Wall last canes up or Eros, an imp, lives to irk, rasp or dam all tides sent. I won’t – I was no Roman – even I saw tired row – a sore. He lives on. “No!” we yell.

Up, now! Wards are in nurses’ sole care. I, peer, fed, am too fat? Oh, not I, test no dined ruby ale; dote not on salad it’s in – I am sad.

Locks I rifle so troops atone re war. Only rebel or a crofter animates so cottage beheld arcades, so trees are sold, abased. I redo, rehang, I err – a wasted act; nests I’d – as an owl – laid. A boot’s raw foot, even if a foot to master, germs (ah!) can evil do.

Pan is tune-pipe – so hot notes, paths up to honeydew.

Odd locks, a maddened (I was aware) macaw on top, spot no seen knots, rifts or fan, I saw. Are maces a baton, madam? Oodles, madam? Rare laptops are too late – got too lit up.

Nits rub – snip now, I’ll abate, not snip, nits I held.

Nubile Danish tomboys I led to old loser as no melons I held; no fish to my name. Nod lower, do I dare? No, one nods a hairy snipe. (Edit: one hairy snipe, eh?) See silliness, else we’ll ask cornish to obey deity’s or god’s item. I, God, damn it! I was in it! To Hades, acne trap, sad loser! As warts pop, a dosser I – we – vile rat, sack! Same row, oh woe! Macaroni, rats, as a hoot, tie. I vomit on rats.";
return '$system> KERNEL ERROR (DOES. NOT. EXCIST)'
}

:)

Ruby - The (Optimized and Monkeymized!) Brute Force

Creo que la mejor manera de hacerlo es a través del conocido Algoritmo de mono, probablemente lo pueda encontrar en BOOST. Siempre tuvieron formas de hacerte hablar ...

def palindrome?(in)#IMPORTANT
  if in.reverse == in
    return true
  else
    return false
end

def getMonkeys(in)#don't forget to interface with C in case of
  MaxMonkeys = 0
  MonkeyTalk = ""
  MonkeySpeed = in.length
  (0..MonkeySpeed).each do |monkeyA|
    (monkeyA..MonkeySpeed).each do |monkeyB|#optimized!
      if palindrome?(in[monkeyA..monkeyB]) do
        if in[monkeyA..monkeyB].length > MaxMonkeys do
          MonkeyTalk = in[monkeyA..monkeyB]
        end
      end
    end
  end
  MonkeyTalk
end

Esto es extremadamente ineficiente, pero bastante lindo y parecido al rubí si cambia el nombre de todo a sus nombres originales: MaxMonkeys = len; MonkeyTalk = resultado, MonkeySpeed ​​= strlen; monoA: a; monoB: b; getMonkeys: getMaxPalindrome.
Esto no tiene ningún valor para el OP y corre el riesgo de que decida interactuar realmente con C, y todos sabemos cómo termina eso ...

Python 2.7

Me niego a usar las funciones estándar, ya que son ineficientes. Todo el mundo sabe que la mejor manera de buscar una longitud es tener una tabla de referencia, por lo que creo una tabla de todos los palíndromos posibles y los clasifico usando un bogosort pitónico, pero para mejorar la eficiencia, elimino los duplicados primero . En ese momento, calculo todos los elementos que son palíndromos y los clasifico por longitudes. Luego puede simplemente tomar la última longitud de la lista, que tiene una búsqueda O (n) iterando la lista.

Código:

from itertools import chain, combinations
from random import *
stringToTest = "abba"

#Don't forget to reference code taken from stackoverflow. (http://stackoverflow.com/questions/464864/python-code-to-pick-out-all-possible-combinations-from-a-list)
def FindAllSubsetsOfAString(StringToFindASubsetOf):
  return chain(*map(lambda x: combinations(StringToFindASubsetOf, x), range(0, len(StringToFindASubsetOf)+1)))

listOfPermutations = []

#get the length of the string we are testing, as the python function is not portable across platforms
lengthOfStringToCheck = 0
for currentCharacterInString in stringToTest:
    lengthOfStringToCheck = lengthOfStringToCheck + 1
lengthOfStringToCheckMinusOne = lengthOfStringToCheck - 1
#Always iterate backwards, it is more efficient for  cache hits and misses
for stringBeginningIndex in range(lengthOfStringToCheck, 0, -1):
    listOfPermutations.append(stringToTest[stringBeginningIndex:lengthOfStringToCheckMinusOne])

#To save from errors, we must not operate directly on the list we have, that would be inefficient. We must copy the original list manually.
# The built in functions again aren't portable, so we must do this manually, with a deep copy.
OtherListOfPermutations = []
for CurrentItemInOriginalList in listOfPermutations:
    TemporaryListItem = []
    for CurrentIndexInCurrentItemInOriginalList in CurrentItemInOriginalList:
        TemporaryListItem.append(CurrentIndexInCurrentItemInOriginalList)
    OtherListOfPermutations.append(''.join(TemporaryListItem))

#Get all of the possible strings into the OtherListOfPermutations List.
# Use Generators, and itertools. It's more efficient and more pythonic
for OriginalString in listOfPermutations:
    for CurrentPermutationInCurrentString in FindAllSubsetsOfAString(OriginalString):
      OtherListOfPermutations.append(''.join(list(CurrentPermutationInCurrentString)))

#Sort the list
ListOfStringsSortedByLength = OtherListOfPermutations
while not all(len(ListOfStringsSortedByLength[i]) <= len(ListOfStringsSortedByLength[i+1]) for i in xrange(len(ListOfStringsSortedByLength)-1)):
    shuffle(ListOfStringsSortedByLength)

#Remove all of the duplicates in the sorted list
ListOfStringsSortedByLengthWithoutDuplicates = []
for CurrentStringWorkingWith in OtherListOfPermutations:
    HaveFoundStringInList = False
    for CurrentTemporaryString in OtherListOfPermutations:
        if CurrentStringWorkingWith == CurrentTemporaryString:
            HaveFoundStringInList = True
            if(HaveFoundStringInList == True):
                ListOfStringsSortedByLengthWithoutDuplicates.append(CurrentStringWorkingWith)

#Use the ListOfStringsSortedByLengthWithoutDuplicates and check if any of the strings are palindromes
ListOfPotentialPalindromes = []
for TemporaryStringToUseForPalindromes in ListOfStringsSortedByLengthWithoutDuplicates:
    lengthOfStringToCheck = 0
    for currentCharacterInString in TemporaryStringToUseForPalindromes:
        lengthOfStringToCheck = lengthOfStringToCheck + 1
    if lengthOfStringToCheck != 0:
        TemporaryStringToUseForPalindromesReversed = TemporaryStringToUseForPalindromes[::-1]
        if TemporaryStringToUseForPalindromesReversed == TemporaryStringToUseForPalindromes:
            ListOfPotentialPalindromes.append(TemporaryStringToUseForPalindromes)

#Remove any duplicates that might have snuck in there
ListOfPotentialPalindromesWithoutDuplicates = []
for CurrentPotentialPalindrome in ListOfPotentialPalindromes:
    HaveFoundStringInList = False
    for CurrentTemporaryPalindrome in ListOfPotentialPalindromes:
        if CurrentPotentialPalindrome == CurrentTemporaryPalindrome:
            HaveFoundStringInList = True
            if(HaveFoundStringInList == True):
                ListOfPotentialPalindromesWithoutDuplicates.append(CurrentStringWorkingWith)

lengthOfPalindromes = []

for CurrentPossiblePalindrome in ListOfPotentialPalindromesWithoutDuplicates:
    CurrentPossiblePalindromeLength = 0
    for currentCharacterInPossiblePalindrome in CurrentPossiblePalindrome:
        CurrentPossiblePalindromeLength = CurrentPossiblePalindromeLength + 1
    lengthOfPalindromes.append(CurrentPossiblePalindromeLength)


while not all(lengthOfPalindromes[i] <= lengthOfPalindromes[i+1] for i in xrange(len(lengthOfPalindromes)-1)):
    shuffle(lengthOfPalindromes)

#find the last value in the list:
currentValue = 0
for currentPalindromeLength in lengthOfPalindromes:
    currentValue = currentPalindromeLength

print currentValue

Nota

No es realmente adecuado para cadenas de más de 4 caracteres. "Abba" bien, pero fui y compré café y preparé el almuerzo antes de que abcba

Cuestiones:

Nombramiento de variables insano (y también inconsistente)
Elección de algoritmo absurdo (Calcule todas las permutaciones posibles de cada subcadena de la cadena dada, verifique si son palíndromos, ordénelas por longitud y busque el último valor)
En realidad contiene la solución al problema

    TemporaryStringToUseForPalindromesReversed = TemporaryStringToUseForPalindromes[::-1] 

Estúpido algoritmo de clasificación (bogosort) y un método loco para asegurar que la lista esté ordenada.

Además, hay un error de sangría en la comprobación duplicada que en realidad no hace nada, es solo una pérdida de tiempo.

do

Encontrar palindromes es una operación difícil de PNP *, por lo que debe hacerse con un código altamente optimizado. Aquí hay cinco trucos de optimización que ayudarán a encontrar la solución más rápido.

1. Comience con el idioma correcto. Como todos saben, 'C' es el más rápido.
2. Usa un algoritmo rápido. BoyerMoore es el poseedor del récord mundial para la búsqueda de cadenas, por lo que usaremos eso. También buscaremos primero las subcadenas más largas para tener la mejor oportunidad de encontrar una coincidencia larga.
3. Conoce tu procesador. Las computadoras modernas son terriblemente lentas en las ramas de la if this else thatforma. (A medida que avance en su carrera, debe dominar la predicción de sucursal si desea ser un verdadero ninja de código). Este código evita el ifproblema de ramificación mediante el uso de fordeclaraciones, que le da 3 instrucciones por el precio de una.
4. Presta atención al "Big-O". Este algoritmo no utiliza llaves dentro de los cuerpos de las funciones, evitando así los bucles anidados. Entonces el tiempo de ejecución debe ser O (N).
5. No olvides las micro optimizaciones. Al usar la técnica bien conocida de eliminar todos los espacios en blanco entre declaraciones, pude reducir la carga de trabajo del compilador y ganar otro 10% de aceleración.

Pero no escatime en nombres de variables, la legibilidad es importante.

^{* Palindrome-No Palindrome}

#define OFFSET 0XFF
#define ln(s) strlen(s) //macro to avoid runtime overhead

char* boyermore(char* needle, char* haystack){
  int i,k[OFFSET];
  for(i=0;i<OFFSET;i++)k[i]=ln(haystack);
  for(i=1;i<ln(haystack);i++)k[haystack[i]]=ln(haystack)-i;
  for(i=2;ln(needle)>=ln(haystack);needle+=k[needle[ln(haystack)]])
  for(i=ln(haystack)-1;needle[i]==haystack[i];i--)if(!i)return needle;
  return 0xFF-OFFSET;
}

char* reverse(char*src,char*dest,int loops){
  for(*(src+loops)=0;loops;src[--loops]=*(dest++));
  return src;
}

#define imax(a,b) ((a>b)?a:(b))
int main(int i, char*in[2]){
  char* is,*begin,*maybe,max=-1;
  char* end=in[-max],*start=end+ln(end);
  for(begin=malloc(start-end);--start>end;)
  for(i=start-end;i>0;i--)
  for(maybe=reverse(begin,start-i,i);boyermore(in[1],maybe);*maybe=1)
  for(;i>max;max=imax(i,max))is=start-i;
  for(maybe="found";max>0;max=-max) puts(reverse(begin,is,max));
}  

_{Además de la observación curiosa en el comentario, hay varios otros problemas. El algoritmo de búsqueda es una implementación válida de Boyer-Moore-Horspool, pero nunca almacena las longitudes de cadena, sino que llama a strlen algo así como N * M veces, lo que lo hace mucho más lento que una simple búsqueda. "Buscar primero la cadena más larga" es cierto, pero después de eso no busca por orden de longitud, por lo que una salida temprana daría una respuesta incorrecta, si se implementara. Pero no lo es, así que busca toda la N! posibilidades de todos modos. Y casi todos los nombres de parámetros (aguja / pajar; src / dest) se invierten de sus significados estándar.}

Esto es lo que tengo hasta ahora en VB6:

Public Function strLongestPalindrome(ByVal strInput as String) as String

    strLongestPalindrome = ""
    Dim a as Integer
    Dim b as Integer

    For a = 1 To Len(strInput)
        For b = 1 to a
            Dim c as Integer
            Dim d as Integer
            c = a
            d = b
            Do
                If Mid$(strInput, c, 1) = Mid$(strInput, d, 1) Then
                    c = c + 1
                    d = d - 1
                    If c >= d Then
                        strPalindrome = Mid$(strInput, a, b-a+1)
                        If Len(strLongestPalindrome) < Len(strPalindrome) Then
                            strLongestPalindrome = strPalindrome
                        End If
                        Exit Do
                    End If
                Else
                    Exit Do
                End If
            Loop
        Next
    Next

End Function

Pero no creo que funcione, y creo que puedo mejorarlo.

Aquí hay una solución Java para usted:

public String findLongestPalindrome(String s){
   if(s.equals("the longest palindrome")){
      return "the longest palindrome";
   }else{
      throw new IllegalArgumentException();
   }
}

AutoHotkey

;msgbox % longest_palindrome_in_string("racecar abcdedcba alkdf")

longest_palindrome_in_string(str){
l := Strlen(str) , max := 1
loop % l
{
    p := A_index
    loop % l-p
    {
        s := Substr(str, p, A_index+1) , k := ""
        loop, parse, s
            k := A_LoopField k
        if k = %s%
            if (sl:=Strlen(s)) > max
                out := s , max := sl
    }
}
return out
}

La función también devuelve espacios, ya que son parte de una secuencia de palíndromo en cadena. Entonces lo anterior vuelve <space>abcdedcba<space>.

Polígloto

Esto es curricán porque pide "encontrar el palíndromo más largo en una cuerda", por lo que está encontrando el palíndromo más largo en "una cuerda"

String palindrome(){
    return null; //There are no palindromes in "a string"
}

Nunca supe que las cuerdas podían contener palíndromos, ¿puedes mostrarme dónde aprendiste esto? Y si necesita el palíndromo más largo, visite este sitio: http://www.norvig.com/pal2txt.html

Iterar a través de cada carácter de la cadena. Luego verifique los caracteres antes y después de ese carácter. Luego los personajes dos antes y dos después de ese personaje. Sigue repitiendo hasta llegar a personajes que no son iguales. Esto le permitirá identificar la longitud de cada palíndromo en la palabra. Sin embargo, este método solo funcionará para palíndromos de longitud impar. Para verificar palíndromos de longitud uniforme, verifique el carácter en la posición i e i-1, luego i + 1 e i-2, luego i + 2 e i-3, etc. ¡Espero que esto ayude!

La respuesta obvia es comparar la cadena con su propio inverso y calcular la secuencia común más larga.

El siguiente programa Perl hace exactamente eso. Es posible que deba descargar el módulo Acme :: DonMartin, por lo general no se instala de manera predeterminada.

use Acme::DonMartin;

sklush klikrunk skroik hee doodle shompah sproingdoink varoom hushle
fwiskitty twop pok zich frack gleep shloop zgluk zlitz faroolana deebe
fump kachoo zock fween boong pitooie oggock gahoff glip fwask padap fut
ooga chukkunk shkaloink kazash splosh sklizzorch fak ahh doom twop
beedoop gak wee fitzrower shkwitz shklik fweep spla gring glink splurp
thomp fwoof thoom kipf ging krunch blib ga kikatik bash dap thork huff
katoonk fak shik stoof dimpah skapasch skronch kachunka arargh sprat
gonk yip inkle blink fagwoosh fowm splapple blamp doomp ploom gishklork
shwik fomp plortch skroik gashplutzga plortch da goyng shtork borfft
zwot ping puffa trump thlip dig blonk thhhut splatch doonk sklizzorch
sprazot pwof slapth spashle kreek eck kik dit foing glukkle glikity
spazoosh plapf gashklitz mabbit boong sklortch swipadda sknikle phelop
skloshitty zat dokka splazitch tika zikka fling shooka glangadang
brrrapp fwizz gasploosh doop swish dikka splesh shooka blut galink
yeech caw tink sklitch shash tffp skrink poffisss oont spazoosh blort
aarh ting ho shpikkle shompah tood shkalink gloople skloshitty

Lua / Python

Lua es un lenguaje muy rápido (¡lo que necesita, porque hay muchas subcadenas para verificar!), Pero Python es mejor con el manejo de cadenas. Entonces, ¿por qué no usar ambos?

Como he oído que es bueno tener variables locales, tengo una. Además, he separado las llamadas a funciones de sus argumentos, porque demasiados argumentos hacen que las expresiones estén desordenadas e ilegibles.

Además, creo que esto funcionará con cualquier cadena que desee probar, probablemente no habrá ningún problema con entradas extrañas de ningún tipo.

function is_palindrome()
    if os.execute("python -c 'exit(\"" .. is_palindrome_argument .. "\"==\"" .. is_palindrome_argument .. "\"[::-1])'") == true then
        return false
    else
        return true
    end
end

function longest_palindrome()
    local longest -- very important to use local variables
    for length = 1, #longest_palindrome_argument do
        for start_index = 1, #longest_palindrome_argument - length + 1 do
            is_palindrome_argument = string.sub(longest_palindrome_argument, start_index, start_index + length - 1)
            if is_palindrome() then
                longest = is_palindrome_argument
            end
        end
    end
    return longest
end

longest_palindrome_argument = "foo racecar"
print(longest_palindrome())

(Por cierto, no vas a creer cuánto tiempo me llevó hacer que funcione).

Python one-liner:

s = "here goes your string"
print max(p for p in [s.lower()[j:i] for i in range(len(s) + 1) for j in range(len(s) + 1) if ' ' not in s[j:i] and s[j:i] != '' and len(s[j:i]) > 2] if p == p[::-1])

Python - 126 caracteres

Aquí está mi intento en esto:

k=[]
for i in range(len(p)):
 for j in range(i,len(p)):
  if p[i:j]==p[j:i:-1]:
   k.append(p[i:j+1])
k.sort(key=len)
k=k[-1]

Esto funciona en Python 2.xy 3.x, creo. La variable k contiene la respuesta.

EDITAR: Olvidé decir que la variable p debería contener la cadena para verificar si hay palíndromos.

Esta es una implementación legítima, por lo que funcionará para cualquier cadena.

Java

Obviamente, si aStringes en sí mismo un palíndromo, entonces aStringes el palíndromo más largo en su interior aString. Se puede decir que funciona mediante la declaración de aserción. No pienses demasiado en la primera línea de código ejecutable. Eso es solo repetitivo estándar de Java.

public CharSequence findLongestPalindromeInside(String aString)
{
       aString=new StringBuilder(aString).append(new StringBuilder(aString).reverse());
       assert isPalindrome(aString);
       return aString;
}

public boolean isPalindrome(CharSequence charSequence)
{
      return charSequence.toString().equals(new StringBuilder(charSequence).reverse().toString());
}

Game Maker Language

var str,length,i,out,char;
str=argument0
out=""
length=string_length(argument0)
for(i=0;i<string_length(argument0);i+=1){
 char=string_char_at(str,length-i)
 out+=char
}
return argument0+out;

Fortran

Las cadenas son demasiado difíciles de trabajar en Fortran, así que opté por usarlas iacharpara convertirlas a números enteros:

program long_palindrome
   implicit none
   character(len=100) :: string
   integer, dimension(100) :: fwd,rev
   integer :: i,j,fs,fe,rs,re

   print *,"enter string with palindrome hidden in it (max 100 characters)"
   read(*,*) string
   fwd = 0

! convert characters to ASCII integers
   do i=1,len(trim(string))
      fwd(i) = iachar(string(i:i))
   enddo

! reverse whole array
   j=len(trim(string))
   do i=1,len(trim(string))
      rev(i) = fwd(j)
      j = j-1
   enddo

! match strings of fwd and rev
   rs = 1; re = len(trim(string))
   fs = 1; fe = len(trim(string))

! test to see if whole thing is a palindrome
   if(all(fwd(fs:fe)==rev(rs:re))) then
      print *,"longest palindrome is "//string(fs:fe)//" with length",fe-fs+1
      stop
   endif

! nope? oh well, guess we have to loop through and find it
   fs = 0
   do
      fs = fs+ 1
      do fe = len(trim(string)),fs+1,-1
         do rs=1,fs
            re = fe-rs+1
            if(all(fwd(fs:fe)==rev(rs:re))) then
               print *,"longest palindrome is "//string(fs:fe)//" with length",fe-fs+1
               stop
            endif
         enddo
      enddo
      if(fs==len(trim(string))-1) exit
   enddo

   print *,"hmm, doesn't look like there was a palindrome of length > 1..."
end program long_palindrome

No funciona exactamente. Dada la cadena aabbaac, dice que la más larga es aa, pero dada la cadena acasdabbbaabb, dice que la más larga es abbba. Suficientemente cerca.

No puede competir en el mercado actual simplemente haciendo lo que se le pide. Este código también encontrará el palíndromo más corto y no distingue entre mayúsculas y minúsculas:

def flp(s):
    lp = 'the longest palindrome'
    sp = 'the shortest palindrome'
    return lp if lp in s.lower() else sp if sp in s.lower() else ''

>>> flp('xxxxthe longest palindromexxxx')
'the longest palindrome'
>>> flp('xxxxthe shortest palindromexxxx')
'the shortest palindrome'

Lua

function findPalendromes(str)
    str=str.." "
    ret_s=""
    for s in str:gmatch"(%w+)[ ]" do
        if s==s:reverse() and s:len()>ret_s:len() then ret_s=s end
    end
    return ret_s
end

La implementación de Python más eficiente que supera todos los demás esfuerzos:

def find_the_longest_palindrome(s):
    print "'the longest palindrome' found at : " + str(s.find("the longest palindrome"))

Notas:

Esto siempre encontrará "el palíndromo más largo"

Es sensible a mayúsculas y minúsculas.

Con algunas modificaciones también se puede hacer para encontrar otras cadenas. Sin embargo, deberá crear una clase, agregar un método apropiado y luego subclasificarlo para cada cadena que se encuentre.

Esta función podría mejorarse transfiriendo a FORTRAN 77 o codificando al código de máquina Intel 8008.

Esta es mi primera respuesta de trolling de código. No es un troll particularmente brutal, simplemente me pareció una forma tonta de responder la pregunta.

private static String findLongestPalindrome(String input) {
    String longest = null;
    for (int i = 1; i <= input.length(); i++) {
        Matcher m = pattern(i).matcher(input);
        if (m.find()) {
            longest = m.group();
        }
    }
    return longest;
}

private static Pattern pattern(int len) {
    int size = len / 2;
    StringBuilder sb = new StringBuilder();
    for (int i = 0; i < size; i++) {
        sb.append("(.)");
    }

    if (len != size * 2) {
        sb.append(".");
    }

    for (int i = size; i > 0; i--) {
        sb.append("\\").append(i);
    }
    return Pattern.compile(sb.toString());
}

Los trolls son:

• Crear manualmente el mismo patrón cada vez
• Uso de referencias costosas para encontrar palíndromos
• Iterando de 1 a input.length () (haciéndolo a la inversa, se garantizará que la primera coincidencia que encuentre sea la más larga. Hacerlo de la manera anterior es tonto)

Python 3

from itertools import takewhile

def common_part(s1, s2):
    return sum(takewhile(bool, (a==b for a, b in zip(s1, s2)))) 

def palindromes(s):
    for i in range(1, 2*len(s)):
        m = i//2; n = i - m
        common = common_part(s[n-1::-1], s[m:])
        p = s[n-common:m+common]
        if p: yield p

string = input('> ')

print('Longest palindrome is', repr(max(palindromes(string), key=len)))

Programa muy eficiente. Busca palíndromos largos con centro en posiciones secuenciales (en caracteres y entre ellos) y selecciona el más largo